View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9790_high_14 (Length: 325)
Name: NF9790_high_14
Description: NF9790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9790_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 124 - 312
Target Start/End: Original strand, 21273310 - 21273495
Alignment:
| Q |
124 |
ttaaaagttatttttaattcaataaaatgattattaacctagctacctttgagtttatttgtgcataaaaggaagttagaaattacaatattactatc-t |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21273310 |
ttaaaagttatttttaattcaataaaatgattattaacctagctacctttgagtttatttgtgcataaaaggaagttagaaattacaatattactatctt |
21273409 |
T |
 |
| Q |
223 |
tttacgagattgagctggattgtttgggttgcatgtgctaaatcatgatgactatatatatgcattggactttatgcatggaatatgtct |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21273410 |
tttacgagattgagctggattgtttgggttgcatgtgctaaatcatgatgac----tatatgcattggactttatgcatggaatatgtct |
21273495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 21 - 94
Target Start/End: Original strand, 21273240 - 21273313
Alignment:
| Q |
21 |
agtgaatttttagccactaaacttcttaaaaaatgcttaaaaaagaattccttaactatcgtggttatatttaa |
94 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21273240 |
agtgaatttttagccactaaatttcttaaaaattacttaaaaaagaattcgttaactatcgtggttatatttaa |
21273313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University