View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9790_high_22 (Length: 247)
Name: NF9790_high_22
Description: NF9790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9790_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 11 - 206
Target Start/End: Complemental strand, 36161982 - 36161779
Alignment:
| Q |
11 |
cagagagaaagaaaagtaatgaatctgtg-----cacacaatgtctgcgccgagagagagagcttcttcagtgatggaaaatgaaccgagtaatcttgaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36161982 |
cagagagaaagaaaagtaatgaatctgtggcgtgcacacaatgtctgcgccgagagagag--cttcttcagtgatggaaaatgaaccgagtaatcttgaa |
36161885 |
T |
|
| Q |
106 |
ccagcagcat--at----ccggaaaacctgagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagttttatacaataaccggaaattgaga |
199 |
Q |
| |
|
|||||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36161884 |
ccagcat-atcgatggcaccggaaaacctgagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagttttatacaataactggaaattgaga |
36161786 |
T |
|
| Q |
200 |
gaatgag |
206 |
Q |
| |
|
||||||| |
|
|
| T |
36161785 |
gaatgag |
36161779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 129 - 176
Target Start/End: Complemental strand, 30077173 - 30077126
Alignment:
| Q |
129 |
gagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagttt |
176 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
30077173 |
gagggaaacgaggttgttgcagttgatgaagagggaaggagggagttt |
30077126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 25923155 - 25923102
Alignment:
| Q |
125 |
acctgagggaaacgaggtttgtgcagttgatgaagaaagaaggagggagtttta |
178 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||| |||||||||| |||||||| |
|
|
| T |
25923155 |
accttagggaaacgaggttgctgcagttcatgaataaagaaggagagagtttta |
25923102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University