View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9790_high_31 (Length: 224)
Name: NF9790_high_31
Description: NF9790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9790_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 92
Target Start/End: Original strand, 52877008 - 52877082
Alignment:
| Q |
18 |
ctttacagggtatatgtttaatgataacagtgttgcaattagctcgcttgcctaatattaaggtagatgattgac |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52877008 |
ctttacagggtatatgtttaatgataacagtgttgcaattagctcgtttgcctaatattaaggtagatgattgac |
52877082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 52877159 - 52877207
Alignment:
| Q |
162 |
atcattttcatgtgcatttgatgtcttaggtcgcaactgtactcctttg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52877159 |
atcattttcatgtgcatttgatgtcttaggtcgcaactgtactcctttg |
52877207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University