View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9790_low_36 (Length: 224)

Name: NF9790_low_36
Description: NF9790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9790_low_36
NF9790_low_36
[»] chr1 (2 HSPs)
chr1 (18-92)||(52877008-52877082)
chr1 (162-210)||(52877159-52877207)


Alignment Details
Target: chr1 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 92
Target Start/End: Original strand, 52877008 - 52877082
Alignment:
18 ctttacagggtatatgtttaatgataacagtgttgcaattagctcgcttgcctaatattaaggtagatgattgac 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
52877008 ctttacagggtatatgtttaatgataacagtgttgcaattagctcgtttgcctaatattaaggtagatgattgac 52877082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 162 - 210
Target Start/End: Original strand, 52877159 - 52877207
Alignment:
162 atcattttcatgtgcatttgatgtcttaggtcgcaactgtactcctttg 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
52877159 atcattttcatgtgcatttgatgtcttaggtcgcaactgtactcctttg 52877207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University