View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9791_low_16 (Length: 240)
Name: NF9791_low_16
Description: NF9791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9791_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 51001455 - 51001243
Alignment:
| Q |
13 |
gtgttagctacaattcgtacacatgcttggtacgaagatggagtaataattttgacatgttcannnnnnn-cagcggggtcactattattatttgatcga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
51001455 |
gtgttagctacaattcgtacacatgcttggtacgaagatggagtaataattttgacatgttcattttttttcagccgggtcactattattatttgatcga |
51001356 |
T |
 |
| Q |
112 |
aacacagtcaaattctttcgaaacgatggctactgttggaagaagnnnnnnngt-ggcaagataggagaaggtcatataaagttgaaggtgtgttgttca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51001355 |
aacacagtcaaattctttcgaaacgatggctactgttggaagaagaaaaaaagtaggcaagataggagaaggtcatataaagttgaaggtgtgttgttca |
51001256 |
T |
 |
| Q |
211 |
ttttattagttgt |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
51001255 |
ttttattagttgt |
51001243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University