View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9791_low_20 (Length: 215)
Name: NF9791_low_20
Description: NF9791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9791_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 128 - 191
Target Start/End: Complemental strand, 29673144 - 29673081
Alignment:
| Q |
128 |
taactattataatcactatggcaacatcaacggcttcatcaaacacatggattaacaccaaact |
191 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29673144 |
taactattatcatcactatggcaacatcaacggcttcatcaaacacatggattaacaccaaact |
29673081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University