View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9792_low_20 (Length: 249)
Name: NF9792_low_20
Description: NF9792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9792_low_20 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 249
Target Start/End: Complemental strand, 6371107 - 6370877
Alignment:
| Q |
19 |
agaggattcttaaagagaatgaaccgaaaccggatccgtattggttgagaacattctttagttttgctcccgaggaagctgctaaggtaccttgttatgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6371107 |
agaggattcttaaagagaatgaaccgaaaccggatccgtattggttgagaacattctttagttttgctcctgaggaagctgctaaggtaccttgttatgg |
6371008 |
T |
|
| Q |
119 |
tcattgtgggattttaagtccattgcttgctaatgtttatcttaatgaattggatcacatggtagaagaaatgattgttgagttttttaggccatgtatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6371007 |
tcattgtgggattttaagtccattgcttgctaatgtttatcttaatgaattggatcatatggtagaagaaatgattgttgagttttttaggccatgtatg |
6370908 |
T |
|
| Q |
219 |
tttgattctatatggaagtattcgattgacg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6370907 |
tttgattctatatggaagtattcgattgacg |
6370877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University