View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9792_low_21 (Length: 249)
Name: NF9792_low_21
Description: NF9792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9792_low_21 |
 |  |
|
| [»] scaffold0251 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0251 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: scaffold0251
Description:
Target: scaffold0251; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 26 - 143
Target Start/End: Complemental strand, 6584 - 6467
Alignment:
| Q |
26 |
atatgtttggactacaggaatccaagttgaggagactaatattctagttgttcttcgaaaaaacttagctccctttaaggtgatcatgttctcttagcac |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6584 |
atatgtttggactacaggaatccaagttgaggagactaatattctagttgttcttcgaaaaaacttagctccctttaaggtgatcatgttctcttagcac |
6485 |
T |
 |
| Q |
126 |
tttttaagagaacttatt |
143 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
6484 |
tttttaagagaacttatt |
6467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0251; HSP #2
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 137 - 242
Target Start/End: Complemental strand, 4583 - 4478
Alignment:
| Q |
137 |
acttattcatcattgttagacaggatgcctactagtgtgaattttctccatcgaatggttatttaagatatcttgaatgtaatgtgtatttagtgtggtt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4583 |
acttattcatcattgttagacaggatgcctactagtgtgaattttctccatcgaagggttatttaagatatcttgaatgtaatgtgtatttagtgtggtt |
4484 |
T |
 |
| Q |
237 |
cctttg |
242 |
Q |
| |
|
|||||| |
|
|
| T |
4483 |
cctttg |
4478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University