View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9793_high_6 (Length: 331)
Name: NF9793_high_6
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9793_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 37 - 315
Target Start/End: Original strand, 29259719 - 29259998
Alignment:
| Q |
37 |
taatgatagagagaattaa--attttatctatttaatactttgtactccattttgaatacatttatatggtcaaacattaataattaagttgcaaaagag |
134 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29259719 |
taatgatagagagaatttataattttatctatttaatactttgtacttcattttgaatacatttatatggtcaaacattaataattaagttgcaaaagag |
29259818 |
T |
 |
| Q |
135 |
aaatgtatttattttttgagagaaaaagaggaatgtattaattgatcatgacagatggtaagtagcagccataaatgtgtaacccttcttcatgtctatg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29259819 |
aaatgtatttattttttgagagaaaaagagaaatgtattaattgatcatgacagatggtaagtagcagccataaa--tgtaacccttcttcatgtctatg |
29259916 |
T |
 |
| Q |
235 |
taataaacatacggtggataga-taaaaacttatagtgggaccatgtaatgtatacactttgttttgccgtatcaatttgat |
315 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29259917 |
taataaacatacggtggatagattaaaaacttatagtgggaccatgtaatgcatacactttgttttgccgtatcaatttgat |
29259998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University