View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9793_high_7 (Length: 295)
Name: NF9793_high_7
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9793_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 70 - 278
Target Start/End: Original strand, 759698 - 759907
Alignment:
| Q |
70 |
taaatagtgtattagcatggttgtgca--actttatataatttgtgaaaaattnnnnnnnnnttcatgccccaacaaacacaatgagtgtcgcaacaacc |
167 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
759698 |
taaatagtgtattagcatggttgtacacaactttatataatttgtgaaaaattaaaaaaaa-ttcatgccccaacaaacacaatgcgtgttgcaacaacc |
759796 |
T |
 |
| Q |
168 |
acattcaccacaatcacaacggccacaaccgcatccacgaccgaatttaaaaccatggttgtcagatattctatttgttgtgtcacctaattattgcgag |
267 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
759797 |
acattcactacaatcgcaacggccacaaccgcatccacgaccgaatttaaaaccatggttgtcagatattctatttgttgtgtcacttaattattgcgag |
759896 |
T |
 |
| Q |
268 |
gagtattagtt |
278 |
Q |
| |
|
||||||||||| |
|
|
| T |
759897 |
gagtattagtt |
759907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 54 - 117
Target Start/End: Original strand, 32520112 - 32520175
Alignment:
| Q |
54 |
actctactatagtggataaatagtgtattagcatggttgtgcaactttatataatttgtgaaaa |
117 |
Q |
| |
|
||||| |||| || ||||||||||||| ||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
32520112 |
actctgctatggttgataaatagtgtaatagcatggtggtgtcactttatatagtttgtgaaaa |
32520175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University