View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9793_low_12 (Length: 286)
Name: NF9793_low_12
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9793_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 15 - 270
Target Start/End: Original strand, 26881929 - 26882184
Alignment:
| Q |
15 |
cagagatggctacacgaattgttgatttgtttgatattagaactacaaagatgattttggtaaagggtcaccgaccacaatccctaaagatggttttgta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881929 |
cagagatggctacacgaattgttgatttgtttgatattagaactacaaagatgattttggtaaagggtcaccgaccacaatccctaaagatggttttgta |
26882028 |
T |
|
| Q |
115 |
ttatcattatttgtgtttccaacgcctttgattgcttgattttcaatgtttacttcttctttgtcagtgccatgttgcaccctgtcatcttttgtctgca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882029 |
ttatcattatttgtgtttccaacgcctttgattgcttgattttcaatgtttacttcttctttgtcagtgccatgttgcaccctgtcatcttttgtctgca |
26882128 |
T |
|
| Q |
215 |
aaatagttttgtttcttggttctttattagctacctcttcgcgtgtaacttgaact |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882129 |
aaatagttttgtttcttggttctttattagctacctcttcgcgtgtaacttgaact |
26882184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University