View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9793_low_19 (Length: 241)
Name: NF9793_low_19
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9793_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 61 - 181
Target Start/End: Complemental strand, 24942119 - 24942002
Alignment:
| Q |
61 |
gcaacatgtaactaatagaacaacatatgtcaatatgctcatatgcgtttttgaagtaactttcctctaaaactcacatagtgactcatccaagtctcta |
160 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24942119 |
gcaacatgtaactaatagaacaacatatatcaatatgctcatatgcgttttggaagtaactttcctctaaaactcacatagtgacacatccaagtctcta |
24942020 |
T |
 |
| Q |
161 |
tacgtactcaaacaaacacct |
181 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
24942019 |
tac---ctcaaacaaacacct |
24942002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University