View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9793_low_24 (Length: 228)
Name: NF9793_low_24
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9793_low_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 5 - 228
Target Start/End: Complemental strand, 3174267 - 3174044
Alignment:
| Q |
5 |
caagtacaaatataaagatggtttgtttgaatggtactaattacaatttgtggaaaggtaaatgaaagatttcctaatcgtnnnnnnnttgaatggtact |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3174267 |
caagtacaaatataaagatggtttgtttgaatggtactaattacaatttgtggaaaggtaaatgaaagatttcctaatcgtaaaaaaattgaatggtact |
3174168 |
T |
|
| Q |
105 |
catccctatatccagtgtctactttatcatttttattcttgatttaaatcataatcggttttcaaagaagtataaacttatacgtttgaaatcataaagt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3174167 |
catccctatatccagtgtctactttatcatttttattcttgatttaaatcataatcggttttcaaagaagtatagacttatacgtttgaaatcataaagt |
3174068 |
T |
|
| Q |
205 |
tgatgtataattgataataatttt |
228 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3174067 |
tgatgtataattgataataatttt |
3174044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University