View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9793_low_7 (Length: 367)
Name: NF9793_low_7
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9793_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 8393561 - 8393286
Alignment:
| Q |
1 |
tgtaaactaataagatcacacccatgcctatgcaaggcaggaatagtgccatcagtattgcatctaacatctccagtttgttttctt-gatatattgctg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
8393561 |
tgtaaactaataagatcacacccatgcctatgcaaggcaggaatagtgccatcagtattgcatctaacatctccagtttgttttctttgatatattgcag |
8393462 |
T |
 |
| Q |
100 |
aatgaatgaatcaatgaggtttttggattgttattgttattgttatatgttaggttgtgaataaattaagttttgtttattgagtgtggagaagaaaaga |
199 |
Q |
| |
|
||| ||| ||| ||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8393461 |
aatcaatcaatgaatcaggtttttggattgttattgttat------attttaggttgtgaataaattaagttttgtttattgagtgtggagaagaaaaga |
8393368 |
T |
 |
| Q |
200 |
gatggtgtggtatggtatggtatgggaaatgggaatcattgggtttgttatttcctcttgttttctagtaatttcggtgttc |
281 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
8393367 |
gagggtgtggtatggtatggtatgggaaatgggaatcattgggtttgttattttctcttgttttctagtaattttggtgttc |
8393286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University