View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9793_low_8 (Length: 346)
Name: NF9793_low_8
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9793_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 43 - 120
Target Start/End: Original strand, 2180200 - 2180277
Alignment:
| Q |
43 |
ataagtagaacttaaaacttaatttggtcccttataattttcatatggcccagttacaaaaaataatatccaaattgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2180200 |
ataagtagaacttaaaacttaatttggtcccttataattttcatatggcccagttagaaaaaataatatccaaattgt |
2180277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 271 - 331
Target Start/End: Original strand, 2180689 - 2180749
Alignment:
| Q |
271 |
gatacgttgctgaatgttgatgatgagaagggtattttaccttgtgtatgtctgcgcgcgt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2180689 |
gatacgttgctgaatgttgatgatgagaagggtattttaccttgtgtatgtctgcgagcgt |
2180749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University