View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9793_low_8 (Length: 346)

Name: NF9793_low_8
Description: NF9793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9793_low_8
NF9793_low_8
[»] chr7 (2 HSPs)
chr7 (43-120)||(2180200-2180277)
chr7 (271-331)||(2180689-2180749)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 43 - 120
Target Start/End: Original strand, 2180200 - 2180277
Alignment:
43 ataagtagaacttaaaacttaatttggtcccttataattttcatatggcccagttacaaaaaataatatccaaattgt 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
2180200 ataagtagaacttaaaacttaatttggtcccttataattttcatatggcccagttagaaaaaataatatccaaattgt 2180277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 271 - 331
Target Start/End: Original strand, 2180689 - 2180749
Alignment:
271 gatacgttgctgaatgttgatgatgagaagggtattttaccttgtgtatgtctgcgcgcgt 331  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
2180689 gatacgttgctgaatgttgatgatgagaagggtattttaccttgtgtatgtctgcgagcgt 2180749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University