View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_high_15 (Length: 307)
Name: NF9794_high_15
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 102 - 292
Target Start/End: Complemental strand, 1423554 - 1423367
Alignment:
| Q |
102 |
tactaaaaaacagtcagagagttgcatgcagtaccttatgcatttggtctcctctctcttaagccatgcaatttttgcactctttatatctcaaaaatta |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1423554 |
tactaaaaaacagtcagagagttgcatgcagtaacttatgcatttggtcttctctctct-aagccatgcaatttttgcactctttatatctcaaaaatta |
1423456 |
T |
|
| Q |
202 |
ttattctctctcttggattaacnnnnnnnnnnctctttttcatttgcaagagtgttaaaagaaaatttaggtgaagatctgaagcaattaa |
292 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1423455 |
ttattctctctcttggattaa--tttttttttctctctttcatttgcaagagtgttaaaagaaaatttaggtgaagatctgaagcaattaa |
1423367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 102 - 214
Target Start/End: Complemental strand, 1416809 - 1416702
Alignment:
| Q |
102 |
tactaaaaaacagtcagagagttgcatgcag---taccttatgcatttggtctcctctctcttaagccatgcaatttttgcactctttatatctcaaaaa |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||| |||| ||||||||| |
|
|
| T |
1416809 |
tactaaaaaacaatcagagagttgcatgcagaagtaccttatgcatttggtctcctctct-------catccaatttttgcactc-ttatctctcaaaaa |
1416718 |
T |
|
| Q |
199 |
ttattattctctctct |
214 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
1416717 |
ttattactctctctct |
1416702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 12 - 63
Target Start/End: Complemental strand, 1423640 - 1423593
Alignment:
| Q |
12 |
acagacaacatctcaactaatattttacgtaacattttcaggacgatcttag |
63 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1423640 |
acagacaacatctcaactaatattt----taacattttcaggacgatcttag |
1423593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University