View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_high_27 (Length: 244)
Name: NF9794_high_27
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_high_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 5479534 - 5479758
Alignment:
| Q |
1 |
tttcaatcggagcggcacgtgggttacactaccttcataccggtgcaaagaacatgattattcaccgtgatgtgaaaaccacaaatattctgttagatga |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
5479534 |
tttcaattggagcggcacgtgggttacactaccttcatactggtgcaaagaacatgattattcaccgtgacgtgaaaacgacaaatattctgttagatga |
5479633 |
T |
|
| Q |
101 |
taaatggatagcaaaggtttccgattttgggctttcgaggattgggcctatgggtatttcgaaagcccatgttagtacggttgttaaagggagtgttggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5479634 |
taaatggatagcaaaggtttccgattttgggctttcgaggattgggcctatgggtatttcaaaagcccatgttagtacggttgttaaagggagtgttggg |
5479733 |
T |
|
| Q |
201 |
tatttagacccggagtattataaac |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5479734 |
tatttagacccggagtattataaac |
5479758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University