View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_high_30 (Length: 242)
Name: NF9794_high_30
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38619204 - 38618972
Alignment:
| Q |
1 |
gggaaataagacattaatcaactgttgcaagtaattaatggaacgtaagtgttgcttnnnnnnncaaagtttagctagttaatttgacatttcagccatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38619204 |
gggaaataagacattaatcaactgttgcaagtaattaatggaacgtaagtgttgcttaaaaaaacaaagtttagctagttaatttgacatttcagccatt |
38619105 |
T |
 |
| Q |
101 |
attataaatttattagtgc---------aattaaaatttattgataaaacgtcgttttcttactttcctcccccc-accttcaatacacggtacatagat |
190 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38619104 |
attataaatttattagtgcttttagtgcaattaaaatttattgataaaacgtcgttttcttactttcctcccccccaccttcaatacacggtacatagat |
38619005 |
T |
 |
| Q |
191 |
ttacgtacgtaggtccacgaatgtaccgcatga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38619004 |
ttacgtacgtaggtccacgaatgtaccgcatga |
38618972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University