View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9794_high_36 (Length: 235)

Name: NF9794_high_36
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9794_high_36
NF9794_high_36
[»] chr4 (1 HSPs)
chr4 (20-229)||(51575085-51575294)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 51575294 - 51575085
Alignment:
20 gggtctacaccaagaaatcaatgggtggatcgtatcggaacctaactattcaaattcttctcctcacacgtttgctattgatggaaatattatcgaggca 119  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
51575294 gggtctacaccaagaaatcaatgggtggatcgtatcggaacctgactattcaaattcttctcctcacacgtttggtattgatggaaatattatcgaggca 51575195  T
120 agtccaaatgccagggtggcttcatctacaccaatcgctaatgtcgaacccaactcaaattttgtgaatgaaccattgcctagaaattttagttttcctg 219  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51575194 agtccaaatgccagggtggtttcatctacaccaatcgctaatgtcgaacccaactcaaattttgtgaatgaaccattgcctagaaattttagttttcctg 51575095  T
220 atccgtctct 229  Q
    ||||||||||    
51575094 atccgtctct 51575085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University