View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9794_high_38 (Length: 226)

Name: NF9794_high_38
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9794_high_38
NF9794_high_38
[»] chr2 (2 HSPs)
chr2 (8-119)||(369849-369960)
chr2 (165-209)||(369972-370016)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 369849 - 369960
Alignment:
8 agtagcataggatagcacatttagaaactttgatatcaggtttcagtgagaaaaatgctgtactgattcacttatgtttcttaacatatcaagtcagcag 107  Q
    ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
369849 agtagcagaggatagcacatttagaaactttgatctcaggtttcagtgagaaaaatgctatactgattcacttatgtttcttaacatatcaagtcagcag 369948  T
108 cagctttgaaat 119  Q
    ||||||||||||    
369949 cagctttgaaat 369960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 369972 - 370016
Alignment:
165 aagtttcatgttagttcaaatacatgtgtaaactatatcaagatt 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
369972 aagtttcatgttagttcaaatacatgtgtaaactatatcaagatt 370016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University