View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_21 (Length: 303)
Name: NF9794_low_21
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 298
Target Start/End: Original strand, 2993915 - 2993977
Alignment:
| Q |
236 |
attggtcaaggtgtgcatggaagattgtggcattcacaaatcgatatcactgtctctgcttct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
2993915 |
attggtcaaggtgtgcatggaagattgtggcattcacaaatcgatatcactgtgtctgtttct |
2993977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 58 - 131
Target Start/End: Original strand, 2974843 - 2974916
Alignment:
| Q |
58 |
aaaacaaagacttttcttggattaacattttatttcttccctttcatatttattagtagttcagggaaattgat |
131 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
2974843 |
aaaacaaagacttttctttgattatcattatatttcttcccttgcatatttatcagtagttcagggaaattgat |
2974916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 2974744 - 2974788
Alignment:
| Q |
17 |
aagcaattcatttgggtttttcatattgtaaaatttattataaaa |
61 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
2974744 |
aagcaattcatttgggtttgtcattttgtaaaatttattataaaa |
2974788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 161 - 240
Target Start/End: Complemental strand, 3918053 - 3917976
Alignment:
| Q |
161 |
ctttgagtaagttgtgtaattcatttataaaattgaagcatttataagatatctttgcttacgtgactgtgaaagattgg |
240 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
3918053 |
ctttgagtgagttgtgtacttcatttataaaattgaagcatt--taagatatcttagcttatgtgactgtgaaagattgg |
3917976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University