View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_25 (Length: 266)
Name: NF9794_low_25
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 53 - 262
Target Start/End: Original strand, 42897065 - 42897274
Alignment:
| Q |
53 |
agtgctaactgccaatagttacaacttactacaatataagcggatcattacacgattacagtaacaacaaatgtcttcagtatactatattttgttttaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897065 |
agtgctaactgccaatagttacaacttactacaatataagcggatcattacacgattacagtaacaacaaatgtcttcagtatactatattttgttttaa |
42897164 |
T |
 |
| Q |
153 |
ccttatatcattacacttatagcattttgcttttacccttgatcgcaacagtgtaatatgttttttgttttcagcctgttacacgcatataagatacgcc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897165 |
ccttatatcattacacttatagcattttgcttttacccttgatcgcaacagtgtaatatgttttttgttttcagcctgttacacgcatataagatacgcc |
42897264 |
T |
 |
| Q |
253 |
tttgcttctc |
262 |
Q |
| |
|
||||||||| |
|
|
| T |
42897265 |
attgcttctc |
42897274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University