View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_28 (Length: 257)
Name: NF9794_low_28
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 36207016 - 36207254
Alignment:
| Q |
1 |
gtagcatgagtgactgtcttatcattgttcttttcattttgggcgtgttgctgactatattgaagggactctaggagagaaacgatcaagtacaaatagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207016 |
gtagcatgagtgactgtcttatcattgttcttttcattttgggcgtgttgctgactatattgaagggactctaggagagaaacgatcaagtacaaatagg |
36207115 |
T |
 |
| Q |
101 |
tggagccatagaacagaactgaccaatagaaacccaaaatagtataaatcacaataaccagaaccttcccagtgaagatgaactttaccggagaaaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207116 |
tggagccatagaacagaactgaccaatagaaacccaaaatagtataaatcacaataaccagaaccttcccagtgaagatgaactttaccggagaaaaaag |
36207215 |
T |
 |
| Q |
201 |
atcgatatcgaaagttccaagtagaacccagcaaaaaac |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36207216 |
atcgatatcgaaagttccaagtagaacccagcaaaaaac |
36207254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 10989274 - 10989228
Alignment:
| Q |
1 |
gtagcatgagtgactgtcttatcattgttcttttcattttgggcgtg |
47 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
10989274 |
gtagcataagtgactaccttatcattgttcttttcagtttgggcgtg |
10989228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University