View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_31 (Length: 252)
Name: NF9794_low_31
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 237
Target Start/End: Complemental strand, 43765652 - 43765430
Alignment:
| Q |
16 |
accttgcgtaacattgtccttaccaactatgctaatcttacgggaagttcggtttacaatttgtctaactagtataannnnnnnn-ccaatagtgtaatt |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43765652 |
accttgcataacattgtccttaccaactatgttaatcttacgggaagttcggtttacaatttgtctaactagtataatttttttttccaatagtgtaatt |
43765553 |
T |
 |
| Q |
115 |
aaaaagtgatgttgtatagtttgagttaattctaatcataacctcagctttgagtttggcattttcaatacgtagttgttgttcttcagttgccatggta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43765552 |
aaaaagtgatgttgtatagtttgagttaattctaatcataacctcagctttgagtttggcattttcaatacgtagttgttgttcttcagttgccatggta |
43765453 |
T |
 |
| Q |
215 |
ccatctctatttgtggtggggac |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43765452 |
ccatctctatttgtggtggggac |
43765430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University