View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_32 (Length: 250)
Name: NF9794_low_32
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 219
Target Start/End: Original strand, 11138394 - 11138479
Alignment:
| Q |
129 |
atgtctgacaagctctatattataatataaagagcatctcatatactctcattcatcgtctattcatcttttgatcaatatcattttctat |
219 |
Q |
| |
|
|||||| ||||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11138394 |
atgtctcacaagctctatat-ataatata--gagcatctcatatactc--atttatcgtctattcatcttttgatcaatatcattttctat |
11138479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 11138268 - 11138325
Alignment:
| Q |
1 |
tcttcctttttgttagacaacctacctccactttttgtttataggggtgctcgtggggtg |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11138268 |
tcttcctttttgttagacaacctacctccactttttgtttataggg--gctcgtggggtg |
11138325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 193 - 231
Target Start/End: Original strand, 39994994 - 39995032
Alignment:
| Q |
193 |
catcttttgatcaatatcattttctatgaattttactct |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39994994 |
catcttttgatcaatataattttctatgaattttactct |
39995032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 229
Target Start/End: Original strand, 28461141 - 28461173
Alignment:
| Q |
197 |
ttttgatcaatatcattttctatgaattttact |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
28461141 |
ttttgatcaatataattttctatgaattttact |
28461173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University