View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_33 (Length: 247)
Name: NF9794_low_33
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 13765997 - 13766225
Alignment:
| Q |
1 |
ttgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatggtcgatattgatttcattcatatttctaatttggataatgtcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
13765997 |
ttgtgaatttctttacgcatcatttctcagacccatagacctatagaccgaccatgggcgatattgatttctttcatatttctaatttggataatgttct |
13766096 |
T |
|
| Q |
101 |
gttgttagctctagtcttggtttcaaaaatggaattggtggtttctagtgtggatggtaacgagatccctataccggacggatttaatctcaacttcttt |
200 |
Q |
| |
|
||||| ||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
13766097 |
gttgtcagctcaattcttggtttcaaaaatggaattggtggtttctagtctggatggtaacgagagccctaggccggacggatttaatctcaacttcttt |
13766196 |
T |
|
| Q |
201 |
acacggttgcgaaatatgttgaaagctga |
229 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
13766197 |
atacggttgcgaaatatgttgaaagctga |
13766225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University