View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_45 (Length: 235)
Name: NF9794_low_45
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 51575294 - 51575085
Alignment:
| Q |
20 |
gggtctacaccaagaaatcaatgggtggatcgtatcggaacctaactattcaaattcttctcctcacacgtttgctattgatggaaatattatcgaggca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51575294 |
gggtctacaccaagaaatcaatgggtggatcgtatcggaacctgactattcaaattcttctcctcacacgtttggtattgatggaaatattatcgaggca |
51575195 |
T |
|
| Q |
120 |
agtccaaatgccagggtggcttcatctacaccaatcgctaatgtcgaacccaactcaaattttgtgaatgaaccattgcctagaaattttagttttcctg |
219 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51575194 |
agtccaaatgccagggtggtttcatctacaccaatcgctaatgtcgaacccaactcaaattttgtgaatgaaccattgcctagaaattttagttttcctg |
51575095 |
T |
|
| Q |
220 |
atccgtctct |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
51575094 |
atccgtctct |
51575085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University