View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_49 (Length: 227)
Name: NF9794_low_49
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 30728867 - 30729027
Alignment:
| Q |
18 |
gaaaaaatattcgatgtttgtgtgatatttgatataaaaaatctgcccctatgaatttgacaggagttcatatttataataaatggcaaaagttagtttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30728867 |
gaaaaaatattcgatgtttgtgtgatatttgatataaaaaatctgcccctatgaatttgacaggagttcatatttataataaatggcaaatgttagtttt |
30728966 |
T |
|
| Q |
118 |
taaaaaataaatggcagctttaaacgaataaactttttaacggtaaatgttagcattttag |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||| ||| ||||||| |
|
|
| T |
30728967 |
taaaaaataaatggcagctttaaacgaataaattttttaacggcaaatgatagtattttag |
30729027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University