View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9794_low_50 (Length: 226)
Name: NF9794_low_50
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9794_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 369849 - 369960
Alignment:
| Q |
8 |
agtagcataggatagcacatttagaaactttgatatcaggtttcagtgagaaaaatgctgtactgattcacttatgtttcttaacatatcaagtcagcag |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
369849 |
agtagcagaggatagcacatttagaaactttgatctcaggtttcagtgagaaaaatgctatactgattcacttatgtttcttaacatatcaagtcagcag |
369948 |
T |
 |
| Q |
108 |
cagctttgaaat |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
369949 |
cagctttgaaat |
369960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 369972 - 370016
Alignment:
| Q |
165 |
aagtttcatgttagttcaaatacatgtgtaaactatatcaagatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
369972 |
aagtttcatgttagttcaaatacatgtgtaaactatatcaagatt |
370016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University