View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9794_low_51 (Length: 213)

Name: NF9794_low_51
Description: NF9794
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9794_low_51
NF9794_low_51
[»] chr5 (1 HSPs)
chr5 (16-198)||(40186534-40186715)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 40186715 - 40186534
Alignment:
16 agaataacacagatatatgaaagagcaaatttggattactttacagacaatgaaggaaaaagggtttttacctcatttggcaatttcatcatggtttgaa 115  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
40186715 agaataacacagctatatgaaagagcaaatttggattactttacagacaatgaaggaaaaagggtttt-acctcatttggcaatttcatcatggtttgaa 40186617  T
116 aaggataaaaagatgattagtgatggcgtggctctttcacacttttatagtgagatgcttcaggaaagtacaatgcaaagtgt 198  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40186616 aaggataaaaagatgattagtgatggcctggctctttcacacttttatagtgagatgcttcaggaaagtacaatgcaaagtgt 40186534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University