View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_high_7 (Length: 276)
Name: NF9795A_high_7
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 276
Target Start/End: Complemental strand, 13768236 - 13767990
Alignment:
| Q |
9 |
tattattctgttccatcctttcatagttctccttttcatatattcatatatgtgtatttctactgtcatcgtctgttagtaaattggaaaaatgagattc |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13768236 |
tattattctgttccatcctttcatagttctccttttcatatattcatatatttgtatttctactgtcatcgtctgttagtaaattggaaaaatgagattc |
13768137 |
T |
 |
| Q |
109 |
atgttgcatttgttggcttcaattttgttttcaattgatatgtcattacaccatgctctcatgtaattacaccgtattacatgccttaaagatttgcatc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13768136 |
atgttgcatttgttggcttcaattttgttttcaattgatatgtcattac---------------------accgtattacatgccttaaagatttgcatc |
13768058 |
T |
 |
| Q |
209 |
ctgttgatagttttttgctgattatttattgctggtagctcttctgttattgttcttcctttcgtgtg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13768057 |
ctgttgatagttttttgctgattatttattgctggtagctcttctgttattgttcttcctttcgtgtg |
13767990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 11 - 67
Target Start/End: Original strand, 14298 - 14354
Alignment:
| Q |
11 |
ttattctgttccatcctttcatagttctccttttcatatattcatatatgtgtattt |
67 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
14298 |
ttattctgttccatcctttcatagttgtccttctcatatattcatttatgtgtattt |
14354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University