View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9795A_low_124 (Length: 302)

Name: NF9795A_low_124
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9795A_low_124
NF9795A_low_124
[»] chr1 (2 HSPs)
chr1 (3-107)||(9303414-9303518)
chr1 (220-302)||(9303619-9303702)


Alignment Details
Target: chr1 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 3 - 107
Target Start/End: Original strand, 9303414 - 9303518
Alignment:
3 cgactttggtgttattgctttgtgtggttggttgactggttttggtgatgttgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttgg 102  Q
    |||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||    
9303414 cgactttgatgttattgctttgtgtggttggttgactggttttggtggtgatgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttgg 9303513  T
103 ttacg 107  Q
    |||||    
9303514 ttacg 9303518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 220 - 302
Target Start/End: Original strand, 9303619 - 9303702
Alignment:
220 attactggtttatgatggtatcagacaaggtttggaattagg-ttgatgcaaaatttggcagctttccttgtgttttttcttga 302  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
9303619 attactggtttatgatggtatcagacaaggtttggaattagggttgatgcaaaatttggcagctttccttgtgttttttcttga 9303702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University