View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_134 (Length: 293)
Name: NF9795A_low_134
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_134 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 6 - 293
Target Start/End: Original strand, 39991701 - 39991987
Alignment:
| Q |
6 |
cgctatgaagaatagacagacacaacaccaacaccaacatgtaaacattggtaacaatttgaggaaatttaattggttgaaaatgatcaaatgtgttggt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39991701 |
cgctatgaagaatagacagacacaacaccgacaccaacatgtaaacattggtaacaatttgaggaaatttaattggttgaaaatgat-aaatgtgttggt |
39991799 |
T |
 |
| Q |
106 |
gtccgacatcaacatctattggacaccagacatacattcgatctgcagtactgcatatcaaatgtgctctagcatcaaataagggattaagtttagaaaa |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991800 |
gtccgacatcgacatctattggacaccagacatacattcgatctgcagtactgcatatcaaatgtgctctagcatcaaataagggattaagtttagaaaa |
39991899 |
T |
 |
| Q |
206 |
cattatgtcatatcctcaaatatctctcnnnnnnnnntagaaaagttcaagcttcaaccaattttgcacaagtagttccgacttctga |
293 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991900 |
cattatgtcatatcctcaaatatctctcaaaaaaaaatagaaaagttcaagcttcaaccaattttgcacaagtagttccgacttctga |
39991987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University