View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_141 (Length: 291)
Name: NF9795A_low_141
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_141 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 4 - 290
Target Start/End: Complemental strand, 25164204 - 25163918
Alignment:
| Q |
4 |
ggagaaccagaaggatgtattgaagagatgtgtcgctgctgaaccaaaacacggagagaaatggcaaccagtctcaaaggcagtggagaactctcaccaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25164204 |
ggagaaccagaaggatgtattgaagagatgtgtcgctgctgaaccaaaacacggagagaaatggcaaccagtctcaaaggcagtggagaactctcaccaa |
25164105 |
T |
|
| Q |
104 |
ccaacggaatccatcttgaagaaagtggttattgcacttgggaaggaggagaaggcagctgaggatagtaaacattgatttgccaggactttagaatctt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25164104 |
ccaacggaatccatcttgaagaaagtggttattgcacttgggaaggaggagaaggcagctgaggatagtaaacattgatttgccaggactttagcatctt |
25164005 |
T |
|
| Q |
204 |
tctgtcgnnnnnnntgattgtcgcatctttaccaatggttagttttgaaatttgaacatatgtcaattatgaatagttgaattgttg |
290 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25164004 |
tctgtcgaaaaaaatgattgtcgcatctttaccaatggttagttttgaaatttgaacatatgtcaattatgaatagttgaattgttg |
25163918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 4 - 129
Target Start/End: Complemental strand, 2188585 - 2188460
Alignment:
| Q |
4 |
ggagaaccagaaggatgtattgaagagatgtgtcgctgctgaaccaaaacacggagagaaatggcaaccagtctcaaaggcagtggagaactctcaccaa |
103 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||| ||||||| |||||| |||||||| |||||||| |
|
|
| T |
2188585 |
ggagaatcagaaggatgtattgaagagatgtgttgctgctgaaccgaaacacggggagaaatggcaagcagtctcgaaggcattggagaacgctcaccaa |
2188486 |
T |
|
| Q |
104 |
ccaacggaatccatcttgaagaaagt |
129 |
Q |
| |
|
||||| || ||||||||||||||||| |
|
|
| T |
2188485 |
ccaacagagtccatcttgaagaaagt |
2188460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University