View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_146 (Length: 288)
Name: NF9795A_low_146
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_146 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 282
Target Start/End: Original strand, 5035460 - 5035735
Alignment:
| Q |
7 |
tttggtgttcagcataatcagaaattgtggaagatggctttaatctcaagtacgaggagtgaagacattctatcaaattttgaatgaattgttttatgta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035460 |
tttggtgttcagcataatcagaaattgtggaagatggctttaatctcaagtacgaggagtgaagacattctatcaaattttgaatgaattgttttatgta |
5035559 |
T |
 |
| Q |
107 |
atttaataacttttatagcagtgtttgtgaaataaaaaacttacaaagcacatatattaaagannnnnnnnaaggatatctattaaagaattaaaaaatt |
206 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5035560 |
atttaataacttttataacagagtttgtgaaataaaaaacttacaaagcacatatattaaagattttttttaaggatatctattaaagaattaaaaaatt |
5035659 |
T |
 |
| Q |
207 |
cacttcacaaggattcaactcaaatatcacaataatctttacttgagttatgttgttggtggaaagacctcgtttg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035660 |
cacttcacaaggattcaactcaaatatcacaataatctttacttgagttatgttgttggtggaaagacctcgtttg |
5035735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University