View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_151 (Length: 285)
Name: NF9795A_low_151
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_151 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 5678354 - 5678635
Alignment:
| Q |
1 |
tactaaaatccaacaaaagttagctaacaagaacatgcacaagaaaagagtcaagtacatttgacatatatatacataaacatnnnnnnn--tataccag |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5678354 |
tactaaaatccaacaaaagttagcaaacaagaacatgcacaagaaaagtgtcaagtacatttgacatatatatacataaacataaaaaaaaatataccag |
5678453 |
T |
 |
| Q |
99 |
tcacttgttcttttcatggcactagatagaagctcttgcctcttcacagacaagtcactagcagatgttgtagttttgtctagaccacgatccaccatgg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678454 |
tcacttgttcttttcatggcactagatagaagctcttgcttcttcacagacaagtcactagcagatgttgtagttttgtctagaccacgatccaccatgg |
5678553 |
T |
 |
| Q |
199 |
caagtacagaaagatttctacctcactataaatgaagcagaaaaagattaatgagtcagttatagtataggctcaaggacct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678554 |
caagtacagaaagatttctacctcactataaatgaagcagaaaaagattaatgagtcagttatagtataggctcaaggacct |
5678635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University