View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_206 (Length: 251)
Name: NF9795A_low_206
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_206 |
 | |
|
| [»] scaffold1051 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold1051 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold1051
Description:
Target: scaffold1051; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 2696 - 2467
Alignment:
| Q |
18 |
gacatcatattatgagagttctctttgatattcctatagataattaatgagagtttagaagtatgaagatgtcatgagtgagtaaaatggagttagtgtt |
117 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2696 |
gacaccatattatgagagttttctttgatattcctatagataat----gagagtttagaagtatgaagatgtcatgagtgagtaaaatggagttagtgtt |
2601 |
T |
|
| Q |
118 |
aaattttgtacttaaacaaaaaggggaaaaggaaacaagaaattgaaggttagtttgaggcccaatcattgtttgattctggttgtgctattcttgtttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2600 |
aaattttgtacttaaacaaaaaggggaaaaggaaacaagaaattgaaggttagtttgtggcccaatcattgtttgattctggttgtgctattcttgtttt |
2501 |
T |
|
| Q |
218 |
atgcaattcttgtattctggtcatggttagtttt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2500 |
atgcaattcttgtattctggtcatggttagtttt |
2467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University