View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_207 (Length: 251)
Name: NF9795A_low_207
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_207 |
 |  |
|
| [»] scaffold1051 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold1051 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold1051
Description:
Target: scaffold1051; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 14 - 251
Target Start/End: Original strand, 2205 - 2442
Alignment:
| Q |
14 |
gatggacatcaacaggatttcattaatcacttcttgaggaagatgttcgctcttcttcgccattttgtggaggcacttatgcgtttgagttggactatct |
113 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2205 |
gatggacctcaacaggatttcattaatcacttcttgaggaagatgttcgctcttcttcgccattttgcggaggcacttatgcgtttgagttggactatct |
2304 |
T |
 |
| Q |
114 |
cacactttatttatacacaaaaaatctgttaagttgccttgctcacttgattattccttatttgctactatatgatgaactctttcccaatgcactttgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2305 |
cacactttatttatacacaaaaaatctgttaagttgccttgctcacttgattattccttatttgctactatatgatgaactctttcccaatgcactttgt |
2404 |
T |
 |
| Q |
214 |
aaaatgcattactccactcaaacaaagattgtgcaaaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2405 |
aaaatgcattactccactcaaacaaagattgtgcaaaa |
2442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University