View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_209 (Length: 251)
Name: NF9795A_low_209
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_209 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 32706144 - 32706377
Alignment:
| Q |
18 |
acatcaattaacgcacacaagaacacaaacgattgatcatgaagttttgcgcgttgtaactattctccgacagttgagtgactgctatagtttctcaatt |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32706144 |
acataaattaacgcacacaagaacacaaacgattgatcatgaagttttgcgcgttgtaactattctccgacagttgagtgactgctatagtttctcaatt |
32706243 |
T |
|
| Q |
118 |
atgcaattcttagggtgtagagtacaatgcagcaaaaacctctctactacgcttgagcatttgtccacttatcagtgattatgagccatactcagcagat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32706244 |
atgcaattcttagggtgtagagtacaatgcagcaaaaacctctctactacgcttgagcatttgtccacttatcagtgattatgagccatactcagcagat |
32706343 |
T |
|
| Q |
218 |
accaattgtttcacaggatatatatcttttagaa |
251 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
32706344 |
accaattgtttcacaggatatatttcttttagaa |
32706377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University