View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_236 (Length: 249)
Name: NF9795A_low_236
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_236 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 249
Target Start/End: Complemental strand, 34824669 - 34824436
Alignment:
| Q |
9 |
tgagatggacatcacttgtttagttatcatagatgaataaatacatcgtgccttacaatacttgcgtgctttgtgctaacataagaccttcacgctatag |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | || | ||||| | |
|
|
| T |
34824669 |
tgagatggacattacttgtttagttatcatagatgaataaatacatcgtgccttccaatacttgcgtgctttgtgctt---ttggatgt----gctatgg |
34824577 |
T |
|
| Q |
109 |
ttagagagtatgagcaacaaggtttacatcatttttcttgtgataaatccagtcatacagactacaattttgatgatttagtaacaaggctcgacattta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34824576 |
ttagagagtatgagcaacaaggtttacatcatttttcttgtgataaatccagtcatacagactacaattttgatgatttagtaacaaggctcgacattta |
34824477 |
T |
|
| Q |
209 |
taaacggcaaataaaacccgttccaactcagccatatataa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34824476 |
taaacggcaaataaaacccgttccaactcagccatatataa |
34824436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University