View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_240 (Length: 249)
Name: NF9795A_low_240
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_240 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 34534304 - 34534073
Alignment:
| Q |
18 |
acatcagcttctccaaaaaccggtacagttttaagctctgatcacgctccttcatctgaagctcctgtgactcctggttcaaggcttggatggaagtctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34534304 |
acatcagcttctccaaaaaccggtacagttttaagctctgatcacgctccttcatctgaagctcctgtgactcctggttcaaggcttggatggaagtctt |
34534205 |
T |
|
| Q |
118 |
caagggtttcttatgagagctctgaaaatcggggaggatctaagcctggatcagcagaaaatgaagcttcaaaaccaatttcagaaccaaatagatcctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34534204 |
caagggtttcttatgagagctctgaaaatcggggaggatctaagcctggatcagcagaaaatgaagcttcaaaaccaatttcagaaccaaatagatcctt |
34534105 |
T |
|
| Q |
218 |
ggatggggaaaatgtgacctcatcttcaagag |
249 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| |
|
|
| T |
34534104 |
ggatgaggaaattgtgacctcatcttcaagag |
34534073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University