View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_248 (Length: 248)
Name: NF9795A_low_248
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_248 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 37821678 - 37821438
Alignment:
| Q |
8 |
ttggtgttgcatcttaacttctgtgcacttgagactgacattatgcatgttatacaacaactatctgtctgtacctagttactgcgtgtcaatttagttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37821678 |
ttggtgttgcatcttaacttctgtgcacttgagactgacattatgcatgttatacaacaactatctgtctgtacctagttactgcgtgtcaatttagttc |
37821579 |
T |
|
| Q |
108 |
agttggtgatttagcatgtgctataatactggccaaaactggccatagtactgttctttatttgattattattttgataatgtaatgttttttaacggtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37821578 |
agttggtgatttagcatgtgctataatactggccaaaactggccatagtactgttctttatttgattattattttgataatgtaatgttttttaacggtt |
37821479 |
T |
|
| Q |
208 |
gctactgtaataatcttcatctcttaactatataattatca |
248 |
Q |
| |
|
| |||||||||| | ||||||||||| ||||||||||||| |
|
|
| T |
37821478 |
gatactgtaatactattcatctcttacatatataattatca |
37821438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University