View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_252 (Length: 248)
Name: NF9795A_low_252
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_252 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 3 - 231
Target Start/End: Original strand, 34187109 - 34187337
Alignment:
| Q |
3 |
tgctactcatggcacaactttcatcagatggagaatcaaatacacaagacatgtggttcatcgattcaggctgtagcaaccatatgacaggtagaaagga |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34187109 |
tgctactcatggcacaactttcatcagatggagaatcaaatacacaagacatgtggttcatcgattcaggctgcagcaaccatatgacaggtagaaagga |
34187208 |
T |
|
| Q |
103 |
ctggttttcttcacttgatgcttctttttgtgatgaggtaaaattaggaaataattatgctcttaaggtcaatgggaagggtgttgtcaaacttttgatt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187209 |
ctggttttcttcacttgatgcttctttttgtgatgaggtaaaattaggaaataattatgctcttaaggtcaatgggaagggtgttgtcaaacttttgatt |
34187308 |
T |
|
| Q |
203 |
aatggagttatgcatttggtgaatgatgt |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
34187309 |
aatggagttatgcattttgtgaatgatgt |
34187337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University