View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_255 (Length: 248)
Name: NF9795A_low_255
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_255 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 246
Target Start/End: Original strand, 33735006 - 33735233
Alignment:
| Q |
18 |
aaaatcatagtacacgagctctaaggatgttgaaaccttcatgcacattctggtgaagctgcatggtatttcaaataatattgttttcgacaaggatcgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33735006 |
aaaatcatagtacacgagctctaaggatgttgaaaccttcatacacattctggtgaagttgcatggtatttcaaataatattgttttcgataaggatcgg |
33735105 |
T |
 |
| Q |
118 |
gggtctttgctattcgtttctctcaaagaataattaagttgagtggcacaacctcgatcatcagatcctcctatcatcattaaagaaatggataatcgga |
217 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
33735106 |
gggtctttaatattcgtttctctcaaa-ttttattaagttgagtggcacaacctcgatcatcagatcctcctatcatccttaaataaatggataatcgga |
33735204 |
T |
 |
| Q |
218 |
agctttgaacaaatttttggaattgtact |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33735205 |
agctttgaacaaatttttggaattgtact |
33735233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University