View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_263 (Length: 247)
Name: NF9795A_low_263
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_263 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 7212983 - 7213197
Alignment:
| Q |
19 |
tcatggtaaccataatttcaagaacacccttgtcatttctcattttctttctgtagattattgttttttgttcttgagcaccaacgacaaggaagttaag |
118 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7212983 |
tcatggtaacaatattttcaagaacacccttgtcatttctcatcttctttttgtagattattgttttttgttcttgagcaccaacgacaaggaagttaag |
7213082 |
T |
 |
| Q |
119 |
gtgatgaagaatgctatagaaaactatgaagcggcatttggcaaaacaattaagttccaataatcataannnnnnnnaacagaaaaatgttagacagaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
7213083 |
gtgatgaagaatgctatagaaaactatgaagcggcatttggcaaaacaattaagttccaataatcataattttttttgacggaaaaatgttagacagaca |
7213182 |
T |
 |
| Q |
219 |
gagattttgctaata |
233 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7213183 |
aagattttgctaata |
7213197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University