View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_271 (Length: 246)
Name: NF9795A_low_271
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_271 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 14 - 246
Target Start/End: Original strand, 18269935 - 18270167
Alignment:
| Q |
14 |
ggacatcaacctaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgaatcatggtggctagaagcgataaaagtag |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18269935 |
ggacatcaaccgaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgattcatggtggctagaagcgataaaagtag |
18270034 |
T |
|
| Q |
114 |
ttgaggaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggact |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270035 |
ttgaggaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggact |
18270134 |
T |
|
| Q |
214 |
gaagccctatcccctttatttagacggcatagg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18270135 |
gaagccctatcccctttatttagacggcatagg |
18270167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University