View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_280 (Length: 245)
Name: NF9795A_low_280
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_280 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 36162890 - 36163121
Alignment:
| Q |
7 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaaacctcttgctgtccnnnnnnn-atccgtcttactgcatttaagttga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36162890 |
gctctatcatgtgtcaacttgaatttgacccagctgtatctccttaaggtgaagcctcttgctgtccttttttttatccgtcttactgcattaaagttga |
36162989 |
T |
 |
| Q |
106 |
ttaagactggccttgtatttttactaaactatctgtcttgagttcttgacaattggatgtgccttgtatttttacacgcttgttaattttgccctatttt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36162990 |
ttaagactggccttgtatttttactaaactatctgacttgagttcttgacaattggatgtgccttgtatttttacacgcttgttaattttgccctatttt |
36163089 |
T |
 |
| Q |
206 |
aaactatgctgtggtataactatgtaactcca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36163090 |
aaactatgctgtggtataactatgtaactcca |
36163121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University