View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9795A_low_287 (Length: 245)

Name: NF9795A_low_287
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9795A_low_287
NF9795A_low_287
[»] chr7 (1 HSPs)
chr7 (1-227)||(48141876-48142102)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 48142102 - 48141876
Alignment:
1 ggcagcaaacaaacgatgaatagttacaaatttaggtgtcataaacaacaatcacgagcagcaaggcaaataacaaagtaacnnnnnnngtaaagaatag 100  Q
    |||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||       |||||||||||    
48142102 ggcaacaaacaaactatgaatagttacaaatttaggtgtcataaacatcaatcacgagcagcaaggcaaataacaaagtaacaaaaaaagtaaagaatag 48142003  T
101 agctttttcaaaaggaataaagtatatagtagaaagtagaaacttaaataaagttaaaagtagaccactttgctttagcaactcattcatttatatgcct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||    
48142002 agctttttcaaaaggaataaagtatatagtagaaagtagaaacttaaataaagttaaaagtagaacactttgctttagcaattcattcatttatatgcct 48141903  T
201 gatttcatgtgataaggaacggtatgc 227  Q
    |||| ||||||||||||||||||||||    
48141902 gattgcatgtgataaggaacggtatgc 48141876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University