View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_294 (Length: 244)
Name: NF9795A_low_294
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_294 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] scaffold0005 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 8 - 244
Target Start/End: Original strand, 49825101 - 49825336
Alignment:
| Q |
8 |
agatggacatcatcatacacccgcttcacagcttagttacgccatccatgcttcaagttgccatcagttatctcaactttaaacaacannnnnnnngtct |
107 |
Q |
| |
|
|||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
49825101 |
agatcgacatcatcagacacccgcttcacaacttagttacgccatccatgcttcaagttgccatcagttatctcgactttaaacaacattttttt-gtct |
49825199 |
T |
|
| Q |
108 |
atgaacaaatccagatcagcaggatattcgtcattgtaatgttgtgaagagtcacaaattgattcatcagatgtccttttgaccgcatagttgcgccaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49825200 |
atgaacaaatccagatcagcaggatattcgccattgtaatgttgtgaagagtcacaaattgattcatcagatgtccttttgacagcatagttgcgccaat |
49825299 |
T |
|
| Q |
208 |
tatgcattaagttcccatccgtaattccaaccttaaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49825300 |
tatgcattaagttcccatccgtaatttcaaccttaaa |
49825336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 244
Target Start/End: Complemental strand, 232658 - 232593
Alignment:
| Q |
180 |
gtccttttgaccgcatagttgcgccaat-tatgcattaagttcccatccgtaattccaaccttaaa |
244 |
Q |
| |
|
||||||||||| | ||| ||||||||| | ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
232658 |
gtccttttgacagaataattgcgccaagctctgcatcaagttcccatccgtaatttcaaccttaaa |
232593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 244
Target Start/End: Original strand, 14584717 - 14584782
Alignment:
| Q |
180 |
gtccttttgaccgcatagttgcgccaat-tatgcattaagttcccatccgtaattccaaccttaaa |
244 |
Q |
| |
|
||||||||||| | ||| ||||||||| | ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
14584717 |
gtccttttgacagaataattgcgccaagctctgcatcaagttcccatccgtaatttcaaccttaaa |
14584782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University