View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_296 (Length: 244)
Name: NF9795A_low_296
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_296 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 23378233 - 23378009
Alignment:
| Q |
1 |
ggttttaaggtgatttaagagtgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggattgtgagatgttt-atgttc |
99 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
23378233 |
ggttttgaggtgatttaagagcgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggattgtgagatcaaacatattc |
23378134 |
T |
|
| Q |
100 |
attgagaagtcaatcaatgtgcttaatgtcttgctactcttggttataatgaaagacttgattcgacaaaactctcatccccaaccttctttatttttta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23378133 |
attgagaagtcaatcaatgtgcttaatgtcttgttactcttggttataatgacagacttgattcgacaaaactctcatccccaaccttctttat-tttta |
23378035 |
T |
|
| Q |
200 |
ttacttcataatgattgtagaatgat |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
23378034 |
ttacttcataatgattgtagaatgat |
23378009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University